![[personal profile]](https://www.dreamwidth.org/img/silk/identity/user.png)
- Sun, 20:16: RT @rachelmillman: the kittens at the bodega last night made me lose my gourd https://t.co/cBaY0rklSq
- Mon, 06:57: RT @AlishaRai: AN OVERWHELMING SURPLUS OF DIGGITY https://t.co/OREeFRw4xH
- Mon, 07:00: RT @thephysicsgirl: Proof that DNA is data storage for aliens, and most encoded data is cat videos. At least, according to crazy hypothesis…
- Mon, 07:02: RT @gideondefoe: Also this is a good topic for a point/counterpoint column, more columnists today should stick to weighing in on this https…
- Mon, 07:12: RT @ASmallFiction: If time was a river, she felt like a skipped stone. Memories of touching here, here, here. Her flight too fast, too bri…
- Mon, 07:26: RT @joncstone: the BBC’s interview with Jean Claude Juncker starts off well https://t.co/9HWrP6aXRw
- Mon, 07:26: RT @catclick: https://t.co/EQOtlXhFcU
- Mon, 07:27: RT @estwebber: UKIP's Lord Pearson has asked a detailed question about why he can't access a website. The reply: racist websites are blocke…
- Mon, 07:29: RT @PaulAtTheHug: ROU Beauty and The Right to Refuse Admission @cultureshipname https://t.co/uPUWMcTXC1
- Mon, 07:29: RT @badmachinery: Working in comics is a wonderful introduction to the US healthcare system, as you watch the heroes of your youth die in a…
- Mon, 07:37: RT @edent: .@thephysicsgirl @BAHFest @oxfordhacker Also, a cat's DNA contains the sequence "CATCATCATCATCATCATCATCATCATCAT" https://t.co/u…